4  Random sampling and writing functions

Published

June 1, 2024

Modified

September 19, 2026

By now you can talk to R at the console, store values in objects, and call functions that other people wrote (see the R mechanics chapter). In this chapter we put those pieces together to build something small but real: a little machine that generates random DNA sequences.

That goal is a good excuse to learn two ideas you’ll use constantly. The first is random sampling — asking R to draw values at random, which is the engine behind every simulation in this book. The second is writing your own functions — packaging a few lines of code under a name so you can reuse them with a single call. Every later chapter assumes you can do this, so this is the place to get it under your fingers.

There’s a bigger idea hiding in here, too. By the end you’ll have written a tiny generative model of DNA: a set of rules that can produce sequence data that never existed before. It is a crude model — deliberately so — but it is a genuine cousin, in spirit, of the DNA language models now used in genomics research. Those models learn fantastically complex rules about how bases depend on one another; ours will use one almost laughably simple rule. Seeing the simple version first makes the fancy version far less mysterious.

4.1 What you’ll learn

  • Draw values at random with sample(), and read its arguments.
  • Explain sampling with and without replacement, and why DNA needs with.
  • Recognize the modeling assumptions baked into a simulation — and where they break down in real biology.
  • Write your own function: give it a name, a body, arguments, and defaults.
  • See how a few simple rules add up to a (very basic) generative model.

4.2 The four letters of DNA

DNA is written in an alphabet of four letters — the nucleotide bases adenine, cytosine, guanine, and thymine. We can hold that alphabet in a character vector:

nucleotides <- c("A", "C", "G", "T")
nucleotides
[1] "A" "C" "G" "T"

That’s it — a four-element vector, each element a one-letter string. If c(), quoting, and the idea of a vector feel shaky, the Vectors chapter covers them in depth; here we only need this one small vector to get going.

4.3 Drawing a base at random

To “read” a base off this alphabet at random, we use the sample() function. Like every function, we call it by writing its name followed by parentheses, with the data it should work on inside. Give sample() a vector and it returns one of the elements, chosen at random:

sample(nucleotides, size = 1)
[1] "A"

Run that again and you’ll (usually) get a different letter — that’s the point. The size argument says how many elements to draw. Ask for a few:

sample(nucleotides, size = 3)
[1] "A" "T" "G"
TipArguments have names

size is the name of an argument, and writing size = 3 makes the call easy to read. You can look up the arguments a function accepts with help(sample) or, more briefly, ?sample. Getting in the habit of reading help pages is one of the highest- return skills in R.

4.4 With or without replacement

Now try to draw a whole sequence — say, ten bases:

sample(nucleotides, size = 10)
Error in `sample.int()`:
! cannot take a sample larger than the population when 'replace = FALSE'

R refuses, and the error message tells you why: by default sample() draws without replacement. Picture the four letters as tiles in a bag. Drawing without replacement means each tile, once pulled, is set aside and can’t be drawn again — so from a bag of four tiles you can pull at most four, and you’d just get the same four letters in a shuffled order. That is nothing like DNA, where the same base appears over and over.

What we want is sampling with replacement: pull a tile, write down its letter, then drop it back in the bag before the next draw. Every draw faces the full bag of four, so letters can — and do — repeat. We switch this on with replace = TRUE:

sample(nucleotides, size = 10, replace = TRUE)
 [1] "C" "T" "C" "C" "A" "T" "G" "T" "G" "T"

Now we can draw sequences of any length we like.

ImportantThe assumption hiding in replace = TRUE

Sampling with replacement, the way we’re doing it, makes every position independent of every other: knowing that position 5 is a G tells you nothing about position 6. That is a modeling assumption, and in real DNA it is plainly false. Bases in a coding sequence come in three-letter codons; promoters and binding sites have recurring motifs; whole regions are GC-rich or AT-rich. Real genomes are full of local structure that our independent-draws model ignores entirely.

That doesn’t make the model useless — simple models are often the right starting point, and a deliberately wrong baseline is the thing more realistic models get measured against. But always keep the assumption in view, because the conclusions you draw from a simulation are only as good as the assumptions you fed into it.

4.5 From letters to a sequence

A draw like the one above is a vector of single letters. A biologist usually wants the sequence as one string, "ACGT…". We glue the letters together with paste(), using collapse = "" to join them with nothing in between:

bases <- sample(nucleotides, size = 10, replace = TRUE)
bases
 [1] "A" "A" "C" "T" "C" "C" "G" "G" "A" "A"
paste(bases, collapse = "")
[1] "AACTCCGGAA"

paste() is one of the workhorse string functions; it and its relatives get a fuller treatment in the Vectors chapter. For now it’s just the last step in turning random draws into something that looks like DNA.

4.6 Writing your own function

We now have a recipe — sample with replacement, then paste — that we’ll want to run again and again. Retyping it every time is tedious and error-prone. The fix is to wrap the recipe in a function of our own.

You already call functions all the time (sample(), paste(), mean()). Writing one just means bottling up some code under a new name. Every R function has three parts:

  • a name (so you can call it later),
  • a body (the code that runs), and
  • a set of arguments (the inputs you can vary each time).

You build one with the function keyword, put the body between braces { }, and save the result to a name with <-:

random_sequence <- function(n) {
  bases <- sample(nucleotides, size = n, replace = TRUE)
  paste(bases, collapse = "")
}

Read that as: “random_sequence is a function of one argument, n; it draws n bases with replacement and pastes them into a single string.” A function returns the value of its last line, so random_sequence() hands back the pasted string.

Call it the same way you call any function — name, then parentheses, with a value for n:

random_sequence(n = 10)
[1] "GTAGAATCTT"
random_sequence(n = 30)
[1] "GCACTCGGCCTTTCCATATCTCGTGAACCC"

Each call re-runs the body, so each call gives a fresh sequence. We’ve turned three lines of fiddly code into one reusable verb.

TipA function is just another object

random_sequence is an object, exactly like nucleotides is. Type its name without parentheses and R shows you the code it contains; type it with parentheses and R runs that code. The parentheses are the trigger.

4.6.1 Default arguments

Right now you must supply n every time, or you get an error. Often it’s convenient to give an argument a default — a value R uses when you don’t specify one. Set the default in the function definition with =:

random_sequence <- function(n = 20) {
  bases <- sample(nucleotides, size = n, replace = TRUE)
  paste(bases, collapse = "")
}

Now a bare call produces a 20-base sequence, but you can still override the default when you want a different length:

random_sequence()
[1] "CCTGCACGCCCTAAAGTACA"
random_sequence(n = 50)
[1] "ATTAGGATATTCATCCCTACACTGTATATGCCGAACGTTCTAATAAACGA"

4.6.2 A second argument: base composition

So far every base is equally likely — each of A, C, G, T turns up about a quarter of the time. Real genomes are lopsided: some organisms are strikingly GC-poor (the malaria parasite Plasmodium falciparum) and others GC-rich (many Streptomyces). The sample() function can model that through its prob argument, which takes a vector of relative probabilities, one per element of the alphabet. Let’s expose that as an argument of our own function:

random_sequence <- function(n = 20, prob = NULL) {
  bases <- sample(nucleotides, size = n, replace = TRUE, prob = prob)
  paste(bases, collapse = "")
}

The default prob = NULL tells sample() to fall back on equal probabilities, so the old behavior is unchanged. But now we can ask for, say, a GC-rich sequence by making G and C more likely than A and T (remember the order is A, C, G, T):

# A, C, G, T weighted 1 : 4 : 4 : 1  ->  mostly G and C
random_sequence(n = 50, prob = c(1, 4, 4, 1))
[1] "TGTCGGCCGGGTCACCGCGCGGCCCGAGGCGCGCCCGGGGGCTGGGATCC"

Count the letters and you should see far more Gs and Cs than As and Ts.

4.7 A (very simple) generative model

Step back and look at what we built. random_sequence() is a small generative model of DNA: a set of rules that can manufacture new sequence data. Its rules are just two:

  1. each base is drawn from the four-letter alphabet, and
  2. the draws are independent, each following a fixed probability distribution (uniform by default, or whatever prob you supply).

That is about the simplest generative model of DNA imaginable. The large DNA language models used in modern genomics are generative models too, and in spirit they do the same job — produce, or assign probabilities to, sequence. The difference is in rule 2. Where our model treats every position as independent, a language model makes each base depend on the entire context around it, capturing codons, motifs, regulatory grammar, and long-range structure that ours throws away. They have millions or billions of learned parameters; ours has at most four. Same idea, wildly different complexity — and you now understand the simple end of that spectrum from the inside.

In the next chapter we’ll put this model to work: generate many sequences, summarize each with a single number, and watch a beautiful piece of statistics — the law of large numbers — emerge.

4.8 Exercises

Each solution names the key idea and a one-line why, because the reasoning transfers further than the answer.

  1. Use sample() directly (no custom function) to draw a single random codon — three bases — as a character vector.

    sample(nucleotides, size = 3, replace = TRUE)
    [1] "C" "T" "T"

    size = 3 asks for three draws, and replace = TRUE lets a base repeat — a codon like "TTT" is perfectly legal, so we must sample with replacement.

  2. Explain in one sentence why sample(nucleotides, size = 6) (no replace) throws an error, but sample(nucleotides, size = 6, replace = TRUE) does not.

    Without replacement there are only four tiles to draw from, so you can’t pull six; with replacement each tile goes back in the bag after every draw, so the supply never runs out.

  3. Write a function random_codon() that returns a single three-base string (e.g. "GAT"). Reuse the pattern from random_sequence().

    random_codon <- function() {
      bases <- sample(nucleotides, size = 3, replace = TRUE)
      paste(bases, collapse = "")
    }
    random_codon()
    [1] "GCC"

    Same three parts as before — name, body, (here empty) arguments — just with size fixed at 3 and no inputs to vary.

  4. Our model assumes every base position is independent. Name one real biological feature of DNA that violates that assumption, and say in a sentence why it matters.

    Many answers work: codons (bases come in functional triplets), sequence motifs in promoters and binding sites, CpG islands, or GC-rich/AT-rich regions. Any of these means the base at one position carries information about its neighbors — exactly the dependence our independent-draws model ignores, which is why sequences it generates won’t contain genuine genes or regulatory signals.

  5. Modify a copy of random_sequence() so that it returns the vector of bases instead of a single pasted string. Which line do you remove?

    random_bases <- function(n = 20, prob = NULL) {
      sample(nucleotides, size = n, replace = TRUE, prob = prob)
    }
    random_bases(n = 8)
    [1] "G" "T" "C" "T" "T" "C" "A" "A"

    Drop the paste() line; a function returns its last expression, so making the sample() call the last line returns the raw vector.

4.9 Summary

You can now generate random data and package code for reuse — two skills the rest of the book leans on constantly:

  • sample() draws values at random from a vector; size sets how many and replace = TRUE allows repeats. Building DNA requires sampling with replacement, which models every position as independent — a convenient fiction that real genomic structure violates.
  • You write a function with function(args) { body }, save it with <-, and it returns the value of its last line. Arguments can have defaults, and extra arguments (like prob) let one function cover many cases.
  • Strung together, a couple of simple rules make a generative model — here, a bare-bones one that is, in spirit, the simplest relative of the DNA language models used in research.

Next we’ll generate sequences by the thousands, reduce each to a single summary number — a statistic — and meet the law of large numbers.